Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 478429
End position: 478452
Length: 24

DNA sequence
>NC_021577, from 478429 to 478452 (24 bp); Pseudomonas aeruginosa RP73 CGGCGGCGGCGATGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 477324-478733	Sequence	M062_02170 - adenosylhomocysteinase (Protein is coded in complementary strand; from 478733 to 477324)