Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4846515
End position: 4846538
Length: 24

DNA sequence
>NC_021577, from 4846515 to 4846538 (24 bp); Pseudomonas aeruginosa RP73 GCAGCGGCAACGGTAGCGGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4846275-4846643	Sequence	M062_22485 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 4846643 to 4846275)