Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 525273
End position: 525296
Length: 24

DNA sequence
>NC_021577, from 525273 to 525296 (24 bp); Pseudomonas aeruginosa RP73 GGCGAGGGCGATGGCTAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 522913-525327	Sequence	M062_02355 - TonB-denpendent receptor (Protein is coded in complementary strand; from 525327 to 522913)