Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5498618
End position: 5498641
Length: 24

DNA sequence
>NC_021577, from 5498618 to 5498641 (24 bp); Pseudomonas aeruginosa RP73 TCAGGGTCAGGCTCATGGTCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5498611-5500737	Sequence	M062_25530 - TonB-denpendent receptor (Protein is coded in complementary strand; from 5500737 to 5498611)