Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5825954
End position: 5825977
Length: 24

DNA sequence
>NC_021577, from 5825954 to 5825977 (24 bp); Pseudomonas aeruginosa RP73 CAACGGCAACGCCAGCGGCAACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5825373-5826767	Sequence	M062_26910 - membrane protein (Protein is coded in complementary strand; from 5826767 to 5825373)