Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5855695
End position: 5855718
Length: 24

DNA sequence
>NC_021577, from 5855695 to 5855718 (24 bp); Pseudomonas aeruginosa RP73 CAGGATCAGGGTCTGGATCAGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5854973-5855728	Sequence	M062_27035 - amino acid ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 5855728 to 5854973)