Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 6000672
End position: 6000695
Length: 24

DNA sequence
>NC_021577, from 6000672 to 6000695 (24 bp); Pseudomonas aeruginosa RP73 CCAGCACCAGCACCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5999735-6000811	Sequence	M062_27735 - alginate O-acetyltransferase (Protein is coded in complementary strand; from 6000811 to 5999735)