Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 6006609
End position: 6006632
Length: 24

DNA sequence
>NC_021577, from 6006609 to 6006632 (24 bp); Pseudomonas aeruginosa RP73 ACCAGCACCGGCACCAGGATCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6003774-6007043	Sequence	M062_27750 - hypothetical protein (Protein is coded in complementary strand; from 6007043 to 6003774)