Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 6103032
End position: 6103055
Length: 24

DNA sequence
>NC_021577, from 6103032 to 6103055 (24 bp); Pseudomonas aeruginosa RP73 GCCAGCGCCAGACCCAGCGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6102687-6103142	Sequence	M062_28220 - hypothetical protein (Protein is coded in complementary strand; from 6103142 to 6102687)