Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 6194776
End position: 6194799
Length: 24

DNA sequence
>NC_021577, from 6194776 to 6194799 (24 bp); Pseudomonas aeruginosa RP73 GCGATGGCGGTGGCGATGGCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6194758-6196173	Sequence	M062_28635 - acetyl-CoA carboxylase subunit alpha (Protein is coded in complementary strand; from 6196173 to 6194758)