Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 626358
End position: 626381
Length: 24

DNA sequence
>NC_021577, from 626358 to 626381 (24 bp); Pseudomonas aeruginosa RP73 CGCCGTCGCCTTCGTCGTCGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 625148-627001	Sequence	M062_02895 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 627001 to 625148)