Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 78513
End position: 78536
Length: 24

DNA sequence
>NC_021577, from 78513 to 78536 (24 bp); Pseudomonas aeruginosa RP73 GCCGAAGCCGTAGCCGACGCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 78430-79095	Sequence	M062_00340 - 5'-nucleotidase (Protein is coded in complementary strand; from 79095 to 78430)