Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 90115
End position: 90138
Length: 24

DNA sequence
>NC_021577, from 90115 to 90138 (24 bp); Pseudomonas aeruginosa RP73 TGGCGGAGGCGGGGGCGGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 87998-91102	Sequence	M062_00385 - serine/threonine protein kinase (Protein is coded in complementary strand; from 91102 to 87998)