Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 96857
End position: 96880
Length: 24

DNA sequence
>NC_021577, from 96857 to 96880 (24 bp); Pseudomonas aeruginosa RP73 GCAGGTGCAGGCGCTGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 96052-97401	Sequence	M062_00405 - type VI secretion protein (Protein is coded in complementary strand; from 97401 to 96052)