Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1443422
End position: 1443446
Length: 25

DNA sequence
>NC_021577, from 1443422 to 1443446 (25 bp); Pseudomonas aeruginosa RP73 CCGCGCCGAGCAGCGCCGAGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1443259-1444701	Sequence	M062_06865 - MFS transporter (Protein is coded in complementary strand; from 1444701 to 1443259)