Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2777364
End position: 2777388
Length: 25

DNA sequence
>NC_021577, from 2777364 to 2777388 (25 bp); Pseudomonas aeruginosa RP73 GCGCGGCGCGGCGCTGCTCGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2775488-2777473	Sequence	M062_12710 - cation-transporting ATPase transmembrane protein (Protein is coded in complementary strand; from 2777473 to 2775488)