Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 3039144
End position: 3039168
Length: 25

DNA sequence
>NC_021577, from 3039144 to 3039168 (25 bp); Pseudomonas aeruginosa RP73 GCCGCGGCGCGCAGCGCCTCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3038028-3040304	Sequence	M062_13920 clpA ATP-dependent Clp protease ATP-binding protein (Protein is coded in complementary strand; from 3040304 to 3038028)