Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5411450
End position: 5411474
Length: 25

DNA sequence
>NC_021577, from 5411450 to 5411474 (25 bp); Pseudomonas aeruginosa RP73 GCGCCGCGCTGCGCGCCGCCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5410676-5411809	Sequence	M062_25095 - molecular chaperone DnaJ (Protein is coded in complementary strand; from 5411809 to 5410676)