Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 346971
End position: 346997
Length: 27

DNA sequence
>NC_021577, from 346971 to 346997 (27 bp); Pseudomonas aeruginosa RP73 TGATCAGGCTGATCAGGCTGATCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 346781-347482	Sequence	M062_01555 - amino acid ABC transporter permease (Protein is coded in complementary strand; from 347482 to 346781)