Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4497761
End position: 4497787
Length: 27

DNA sequence
>NC_021577, from 4497761 to 4497787 (27 bp); Pseudomonas aeruginosa RP73 GGTTTCTTCGGCTTCTTCGGTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4497611-4498960	Sequence	M062_20885 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 4498960 to 4497611)