Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4980987
End position: 4981013
Length: 27

DNA sequence
>NC_021577, from 4980987 to 4981013 (27 bp); Pseudomonas aeruginosa RP73 CATGCCGCCCATGCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4980982-4982625	Sequence	M062_23110 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 4982625 to 4980982)