Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5182152
End position: 5182178
Length: 27

DNA sequence
>NC_021577, from 5182152 to 5182178 (27 bp); Pseudomonas aeruginosa RP73 CCGCCGTCGCCACCGTCGCCGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5181060-5182280	Sequence	M062_24040 obgE GTPase CgtA (Protein is coded in complementary strand; from 5182280 to 5181060)