Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5271021
End position: 5271047
Length: 27

DNA sequence
>NC_021577, from 5271021 to 5271047 (27 bp); Pseudomonas aeruginosa RP73 CCGCCTCCCCCGCCTCCCCCGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5270912-5271199	Sequence	M062_24425 - hypothetical protein (Protein is coded in complementary strand; from 5271199 to 5270912)