Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5568903
End position: 5568929
Length: 27

DNA sequence
>NC_021577, from 5568903 to 5568929 (27 bp); Pseudomonas aeruginosa RP73 GCACCGCCAGCACCGGCAGCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5568128-5569468	Sequence	M062_25850 - major facilitator transporter (Protein is coded in complementary strand; from 5569468 to 5568128)