Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 193762
End position: 193791
Length: 30

DNA sequence
>NC_021577, from 193762 to 193791 (30 bp); Pseudomonas aeruginosa RP73 GGCGGGAAGGGGCAGGAAGCGGCGGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 193746-194573	Sequence	M062_00850 - diguanylate cyclase (Protein is coded in complementary strand; from 194573 to 193746)