Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2780078
End position: 2780107
Length: 30

DNA sequence
>NC_021577, from 2780078 to 2780107 (30 bp); Pseudomonas aeruginosa RP73 CCGTGATCGTGATCGTGATCGTGATCGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2779127-2780152	Sequence	M062_12725 - protease (Protein is coded in complementary strand; from 2780152 to 2779127)