Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5479764
End position: 5479793
Length: 30

DNA sequence
>NC_021577, from 5479764 to 5479793 (30 bp); Pseudomonas aeruginosa RP73 GGCCAGGACCAGCGCCAGGGCCAGGGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5478769-5480205	Sequence	M062_25435 - hypothetical protein (Protein is coded in complementary strand; from 5480205 to 5478769)