Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 643001
End position: 643030
Length: 30

DNA sequence
>NC_021577, from 643001 to 643030 (30 bp); Pseudomonas aeruginosa RP73 GCCCGGGCCGGACCGGGGCGGCCAGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 642274-643260	Sequence	M062_02980 pdxA 4-hydroxythreonine-4-phosphate dehydrogenase (Protein is coded in complementary strand; from 643260 to 642274)