Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1180117
End position: 1180152
Length: 36

DNA sequence
>NC_021577, from 1180117 to 1180152 (36 bp); Pseudomonas aeruginosa RP73 GACCATGGACATGACCATGGCCATGGCCATGGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1180005-1180223	Sequence	M062_05640 - zinc chelation protein SecC (Protein is coded in complementary strand; from 1180223 to 1180005)