Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1658005
End position: 1658040
Length: 36

DNA sequence
>NC_021577, from 1658005 to 1658040 (36 bp); Pseudomonas aeruginosa RP73 GCCGCCGCCATGACCGCCGCCATGACCGCCGCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1657811-1658176	Sequence	M062_07875 - hypothetical protein (Protein is coded in complementary strand; from 1658176 to 1657811)