Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2175482
End position: 2175517
Length: 36

DNA sequence
>NC_021577, from 2175482 to 2175517 (36 bp); Pseudomonas aeruginosa RP73 GTCGTCGGCGAAGTCGTCGGCGTGGTCTTGGGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2175087-2176652	Sequence	M062_10230 - heme ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2176652 to 2175087)