Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5991659
End position: 5991694
Length: 36

DNA sequence
>NC_021577, from 5991659 to 5991694 (36 bp); Pseudomonas aeruginosa RP73 TTCGCCGCAGGCTTCGCAGCCGGCTTGGCTGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5991482-5992540	Sequence	M062_27690 - transcriptional regulator (Protein is coded in complementary strand; from 5992540 to 5991482)