Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 6303003
End position: 6303038
Length: 36

DNA sequence
>NC_021577, from 6303003 to 6303038 (36 bp); Pseudomonas aeruginosa RP73 GGTTTGGGCTTGGGTTTCGGCTTGGGCTTGGGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6302514-6303545	Sequence	M062_29120 - cell envelope biogenesis protein TonB (Protein is coded in complementary strand; from 6303545 to 6302514)