Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 84060
End position: 84095
Length: 36

DNA sequence
>NC_021577, from 84060 to 84095 (36 bp); Pseudomonas aeruginosa RP73 CCAGGCCGCCGGCCAGGCCGCCCAGGAGGCCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 83402-84316	Sequence	M062_00365 - hypothetical protein (Protein is coded in complementary strand; from 84316 to 83402)