Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 5771670
End position: 5771714
Length: 45

DNA sequence
>NC_021577, from 5771670 to 5771714 (45 bp); Pseudomonas aeruginosa RP73 CTTGGCTGCCGGCTTCTTCGCCGCAGGCTTTTTCGCAGCCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5771548-5772507	Sequence	M062_26660 - poly(3-hydroxyalkanoate) granule-associated protein PhaI (Protein is coded in complementary strand; from 5772507 to 5771548)