Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 201507
End position: 201530
Length: 24

DNA sequence
>NC_021658, from 201507 to 201530 (24 bp); Sorangium cellulosum So0157-2 GCCCGCGCCTGCGCCCCCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 201099-201962	Sequence	SCE1572_00725 - hypothetical protein (Protein is coded in complementary strand; from 201962 to 201099)