Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 2033533
End position: 2033595
Length: 63

DNA sequence
>NC_021658, from 2033533 to 2033595 (63 bp); Sorangium cellulosum So0157-2 CGCCCGGCGAGGCGGCGAGCGCGCCCGCCGCGGGGGAGAGCGCGCCGGGCGCGGGGGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2033124-2033711	Sequence	SCE1572_07145 - hypothetical protein (Protein is coded in complementary strand; from 2033711 to 2033124)