Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3358005
End position: 3358028
Length: 24

DNA sequence
>NC_021658, from 3358005 to 3358028 (24 bp); Sorangium cellulosum So0157-2 CGCGGGCGCAGGCGCAGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3356167-3358122	Sequence	SCE1572_12135 - hypothetical protein (Protein is coded in complementary strand; from 3358122 to 3356167)