Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3499982
End position: 3500035
Length: 54

DNA sequence
>NC_021658, from 3499982 to 3500035 (54 bp); Sorangium cellulosum So0157-2 CCCGGGCGGGCCTCGCCGGCCGGGCGGGCCGCACCGCCCGGGCGAGCCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3499946-3500950	Sequence	SCE1572_12635 - hypothetical protein (Protein is coded in complementary strand; from 3500950 to 3499946)