Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4211069
End position: 4211092
Length: 24

DNA sequence
>NC_021658, from 4211069 to 4211092 (24 bp); Sorangium cellulosum So0157-2 CGCGGGCGCGCGCCCGGGAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4208297-4211137	Sequence	SCE1572_15045 - hypothetical protein (Protein is coded in complementary strand; from 4211137 to 4208297)