Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5496849
End position: 5496904
Length: 56

DNA sequence
>NC_021658, from 5496849 to 5496904 (56 bp); Sorangium cellulosum So0157-2 CTCTCCCCACATCACTCTCCCCACATCACGCGCCCCACATCACGCGCCCCACATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5495869-5496861	Sequence	SCE1572_19420 - hypothetical protein (Protein is coded in complementary strand; from 5496861 to 5495869)
ORF... 5496903-5501327	Sequence	SCE1572_19425 - hypothetical protein (Protein is coded in complementary strand; from 5501327 to 5496903)