Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5841054
End position: 5841077
Length: 24

DNA sequence
>NC_021658, from 5841054 to 5841077 (24 bp); Sorangium cellulosum So0157-2 CGGAGGCGGCGGGGGAGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5840698-5841498	Sequence	SCE1572_20670 - hypothetical protein (Protein is coded in complementary strand; from 5841498 to 5840698)