Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5983698
End position: 5983742
Length: 45

DNA sequence
>NC_021658, from 5983698 to 5983742 (45 bp); Sorangium cellulosum So0157-2 GGGCAGCCGCGCCGCCGGCGGTCGCGCCGCGGGCCGCCGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5983072-5984397	Sequence	SCE1572_21200 - hypothetical protein (Protein is coded in complementary strand; from 5984397 to 5983072)