Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6187373
End position: 6187397
Length: 25

DNA sequence
>NC_021658, from 6187373 to 6187397 (25 bp); Sorangium cellulosum So0157-2 CGCGCCGCGCCGCGCGGCGCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6187011-6188045	Sequence	SCE1572_21875 - hypothetical protein (Protein is coded in complementary strand; from 6188045 to 6187011)