Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 6542509
End position: 6542553
Length: 45

DNA sequence
>NC_021658, from 6542509 to 6542553 (45 bp); Sorangium cellulosum So0157-2 TCCTCGCCGCCGCCGGTCCCGCCGCCGCCGGTCCCGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6541414-6542703	Sequence	SCE1572_23195 - hypothetical protein (Protein is coded in complementary strand; from 6542703 to 6541414)