Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7237327
End position: 7237362
Length: 36

DNA sequence
>NC_021658, from 7237327 to 7237362 (36 bp); Sorangium cellulosum So0157-2 CCGGCGAGCCGCCCGGCGAGCCGCCCGGTGAGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7235772-7237472	Sequence	SCE1572_25185 - hypothetical protein (Protein is coded in complementary strand; from 7237472 to 7235772)