Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7475225
End position: 7475248
Length: 24

DNA sequence
>NC_021658, from 7475225 to 7475248 (24 bp); Sorangium cellulosum So0157-2 GCTCGACCTCGAGCACGAGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7473454-7475667	Sequence	SCE1572_26035 - hypothetical protein (Protein is coded in complementary strand; from 7475667 to 7473454)