Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8573537
End position: 8573572
Length: 36

DNA sequence
>NC_021658, from 8573537 to 8573572 (36 bp); Sorangium cellulosum So0157-2 CGCGCGTGCGCGCGGGCGCGGGCGCGGGCGCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8572193-8573629	Sequence	SCE1572_30135 - permease (Protein is coded in complementary strand; from 8573629 to 8572193)
ORF. 8573527-8574252	Sequence	SCE1572_30140 - hypothetical protein (Protein is coded in complementary strand; from 8574252 to 8573527)