Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8577359
End position: 8577403
Length: 45

DNA sequence
>NC_021658, from 8577359 to 8577403 (45 bp); Sorangium cellulosum So0157-2 CGGCGCGGGGCTCGGCGGCGCGGGGCCCGGCGGCGCGTCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8577306-8578025	Sequence	SCE1572_30160 - hypothetical protein (Protein is coded in complementary strand; from 8578025 to 8577306)