Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8675976
End position: 8675999
Length: 24

DNA sequence
>NC_021658, from 8675976 to 8675999 (24 bp); Sorangium cellulosum So0157-2 CTTCTCCTTCACCTCCTCCTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8675752-8677848	Sequence	SCE1572_30555 - hypothetical protein (Protein is coded in complementary strand; from 8677848 to 8675752)